INTRODUCTION:

Helicobacter pylori (H. pylori) infection affects around half of the world’s population leading to a variety of gastric problems and is mostly present in asymptomatic form. It is a Gram-negative, microaerophilic, human' gastric' pathogen that usually find in the mucous' lining' of stomach¹.

This' bacterium' plays a crucial role' in the pathogenesis of various diseases' of the digestive system, such as peptic ulcer, gastric adenocarcinoma and chronic gastritis, H. pylori is a well-known' 'risk factor for gastric cancer².

Virulence factors are considered as additional pathogenic factors of an invading microbe that increase the cellular damage of the host. Several reports have investigated the virulence factors of this bacteria and their potential role in triggering gastric cancer. According to Yamaoka and Graham (2014), the most important virulence factors of H. pylori are VacA, dupA and OipA³.

These virulence factors enable successful colonization of the gastric mucosa and sustain persistent H. pylori infection, causing chronic inflammation and tissue damage, which may eventually lead to the development of peptic ulcers and gastric cancer-based on⁴.

An important virulence factor secreted by H. pylori is VacA cytotoxin, which induces vacuolization and cell death in epithelial cells. The encoding vacA gene is present in all H. pylori strains, but it is polymorphic, comprising variable signal regions (type s1 or s2) and midregions (type m1 or m2)⁵.

SUBJECTS, MATERIALS AND METHODS:

In a total of 105 patients' (51 males and 54 females) aged 17 to 85 years, were diagnosed through physicians according to endoscopic findings, complaining' from clinical manifestations of dyspepsia or burning, vomiting, bloating, weight' loss, loss of appetite, dysphagia' and melena were enrolled in this study which was carried out during November 2020- July 2021 (Table 1).

Table 1. Description of the studied patients.

Patients characters (n=105)	Number (%)
Sex
Males	51 (48.57%)
Females	54 (51.42%)
Age (years )	17-85 (Mean 47)
Signs and symptoms
Dyspepsia	31 (29.5%)
Vomiting	18 (17.1%)
Bloating	10 (9.5%)
Weight loss	17 (16.1%)
Loss of appetite	15 (14.2%)
Dysphagia	12 (11.4%)
Melena	2 (1.9%)

In addition, the control group included twenty apparently healthy individuals people of nine males and twelve females; their age matched the patients group, the participants have no any gastrointestinal diseases. Four gastric biopsy samples were collected by gastroenterologists from each patient who underwent upper gastro duodenal endoscopy in the gastroenterology and Hepatology Teaching Center, Baghdad - Iraq.

Three biopsies placed in formalin for histological examination. The last biopsy has been placed in 1 ml of normal saline and' preserved in-20ºC for molecular analysis.

Processing of Samples for PCR Assay:

Extraction of DNA from Biopsy Specimens:

The frozen biopsies' thawed, genomic DNA was then extracted directly from tissue using (Quick Genomic) DNA extraction' kit according to the manufacturer’s instruction. DNA concentration' and purity were measured by Nano drop.

PCR Amplification Analysis:

Identification of H.pylori virulence Gene was carried out using specific'' Primers for vacA, oipA and dupA Genes' for the investigation of presence of H. pylori virulence Genes in collected samples.

The source of all primers used in this study was IDT® (Belgium). The name and sequence are given in Table 2.

Table 2. Name and Sequence of Primers

Name of Primer	Sequence.	References
vacA	5’- GAGCGAGCTATGGTTATGA-3’ 5'- ACTCCAGCATTCATATAGA -3’	Salman et al., 2019
dupA	F 5'- GACGATTGAGCGATGGGAATAT -3’ R 5’- CTGAGAAGCCTTATTATCTTGTTGG-3’	Newly designing
oipA	F 5’- TTACTAACTCTCTCTCTCTCG-3’ 5'- GAGTGCCTAAACCCTATAATC -3’	Newly designing

Optimization' of PCR for each genes (vacA, oipA and dupA) was done separately''

by using different specific sets of primer. 1μl of each primer, 4μl DNA' sample, and 12.5μl OneTaq master' mix (NEB-England) and complete' to the final' volume 25μl using free nuclease water. Then monoplex PCR performed for vacA, dupA and oipA genes' using OneTaq' (NEB^®) master mix (Table 3).

Table 3. Monoplex PCR conditions' for vacA, dupA and oipA genes

Cycle No.	Stage	Temperature	Time
1	Initial Denaturation	94 ºC	1 mins
35x	Denaturation Annealing for vacA Annealing for dupA Annealing for oipA Extension	94 ºC 45 ºC 52 ºC 50 ºC 70 ºC	30 sec. 45 sec. 45 sec.
1	Final Extension	70 ºC	5 mins.

RESULT AND DISCUSSION:

The result of present study clarified that the invasive method by histological test revealed that 78/105 (74.2 %) of patients were positive and distributed by different percentage according to histopathological findings. Histology plays vital role in detecting H. pylori and it also furnished more information about the grade of inflammation and related pathology, such as atrophy gastritis (AG), gastric cancer (GC) and intestinal metaplasia (IM). Same study carried by Salman et al. (2019) found that (54.7%) of samples were' positive to H. pylori by histological test.

Helicobacter pylori has adapted to the harsh milieu of the human stomach through possession of various virulence genes that enable survival of the bacteria in the acidic environment, movement towards the gastric epithelium, and attachment to gastric epithelial cells⁴.

The prevalence of vacA gene in this study was 93.5% which appeared at 517bp (Figuer,1) with highly significant prevalence in all strain of H. pylori revealed high pathogenicity of this strain.

Figure (1): Electrophoresis for detection of vacA gene as a PCR product. Lane C, D and E shows PCR product at 517bp. Lane F shows no PCR product (Negative result). A: DNA ladder (100 bp step), B : Negative control

The current results agree with those found by Ayodeji et al., (2019) who notice that prevalence of vacA gene was (90.6%) predominantly which makes patients likely to be more prone to H. pylori-associated diseases.

The absence of vacA in some strains in the study could be a result of the genetic structure of the strains or exposure to adverse stomach conditions⁶.

VacA inhibits the expansion of the T cells activated by bacterial antigens and thus helps H.pylori evade the adaptive immune response and promotes the persistence of infection⁷.

The oipA gene was found in 53.8% of cases, Its appeared at 400bp (Figure, 2) this result is nearly related to another Iranian study carried out by Kianoosh in 2017 who found that the prevalence of oipA gene was 57%.

Figure (2): Electrophoresis for detection of oipA gene as a PCR product. Lane C, D and E shows PCR product. Lane F shows no PCR product (Negative result). A: DNA ladder (100 bp), B : Negative control

Molecular epidemiology studies show a frequency of oip gene expression up to 70% among H. pylori clinical strains⁸. The results of some studies show that oipA gene expression is directly related to the expression of cagA and vacA genes⁹. Whereas study done by Lúcia et al., (2019)¹⁰ who conclude that oipA “on” status was independently associated with gastric cancer and first-degree relatives of gastric cancer patients in North-eastern Brazil.

Helicobacter pylori is attached to gastric epithelial cells by OipA membrane protein in most H. pylori clinical strains^8,11

current result show that the prevalence of dupA gene was 32.05%, which appeared at 970 bp (Figer-3) this result is similar to Japanese result carried out by Shiota et al. in 2012¹² who found that Prevalence of dupA was higher in the eradication failure group than in the success group (36.3% vs. 21.9%).

Figure (3): Electrophoresis for detection of dupA gene as a PCR product. Lane F shows PCR product. Lane C, D and E shows no PCR product (Negative result). A: DNA ladder (100 bp), B : Negative control

The dup A gene found within the plasticity regions was first demonstrated in 2005 and was proposed for duodenal ulcer development and reduced risk of gastric cancer in certain geographical regions table (4) based on^{13, 14, 15}.

Table (4) Prevalence of virulence genes

Name of Gene	Percentage of result
*vacA*	93.5 %
*oipA*	53.8%
*dupA*	32.05%

The differences in the prevalence of H. pylori with people from the same country may be due to the different number of biopsies analyzed for each patient, the variable number of bacteria harbored by the tissue studied, also the difference in sensitivity and specificity of the PCR method used, the geographic region and the environmental health conditions of the population studied.

The current study results showed some positive relationships among of H. pylori virulence genes detected in gastric biopsy samples of patients with H. pylori pathogenicity.

REFERENCES:

1. M. Muzaheed, (Helicobacter pylori Oncogenicity: Mechanism, Prevention, and Risk Factors). Scientific World Journal. 2020: 10. 10.1155/2020/3018326.

2. F. Bray, J. Ferly, I. Soerjomataram, et al. Globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer Journal Clinical. 68(6): 394–424, 2018. doi: 10.3322/caac.21492.

3. Y. Yamaoka and D. Y. Graham Helicobacter pylori virulence and cancer pathogenesis Future Oncology. 10(8): 1487–1500, 2014. doi: 10.2217/fon.14.29.

4. 1-A. Šterbenc, E. Jarc, M. Poljak, M. Homan. Helicobacter pylori virulence genes. World Journal Gastroenterol. 25(33): 4870-4884, 2019. doi: 10.3748/wjg.v25.i33.4870.

5. L. E. Wroblewski, R.M. Peek, and K. T. Wilson, Helicobacter pylori and gastric cancer: factors that modulate disease risk,”Clinical Microbiology Reviews. 23( 4): 713–739, 2010. doi/10.1128/CMR.00011-10

6. D.M. Da Costa, P.E. Dos Santos, S.H.B. Rabenhorst What exists beyond cagA and vacA? Helicobacter pylori genes in gastric diseases. World Journal Gastroenterol. 21(37):10563–72, 2015. doi: 10.3748/wjg.v21.i37.10563.

7. D.B. Polk, R.M. Peek Helicobacter pylori: gastric cancer and beyond. Nat Rev Cancer. 10:403–14, 2010. DOI: 10.1038/nrc2857.

8. N. Farzi, A. Yadegar, H. A. Aghdaei, Y. Yamaoka and M. R. Zali Genetic diversity and functional analysis of oipA gene in association with other virulence factors among Helicobacter pylori isolates from Iranian patients with different gastric diseases,” Infection, Genetics and Evolution. 60: 26–34, 2018. doi: 10.1016/j.meegid.2018.02.017.

9. K. Torres, E. Valderrama, M. Sayegh, J. L. Ram´ırez, and M. A. Chiurillo Study of the oipA genetic diversity and EPIYA motif patterns in cagA-positive Helicobacter pylori strains from Venezuelan patients with chronic gastritis. Microbial Pathogenesis. 76:26–32, 2014. doi: 10.1016/j.micpath.2014.09.006.

10. L. L. B. C. Braga, M. H. R. Batista, et al. “on” status of Helicobacter pylori is associated with gastric cancer in North-Eastern Brazil. BMC Cancer. 19:48, 2019.

11. H. Sedaghat, R. Moniri, R. Jamali, et al. Frequency of Helicobacter pylori vacA, cagA, cagE, iceA, babA2, and oipA genotypes in patients with upper gastrointestinal diseases, Iranian Journal of Microbiology, 6(1):14–21, 2014.

12. S. Shiota, L.T. Nguyen, K. Murakami, A. Kuroda, et al. Association of Helicobacter pylori dupA with the failure of primary eradication. Journal Clinical Gastroenterol. 46: 297-301, 2012. doi: 10.1097/MCG.0b013e318243201c.

13. J. Alam, A. Sarkar, B. C. Karmakar, et al. Novel virulence factor dupA of Helicobacter pylori as an important risk determinant for disease manifestation. World Journal Gastroenterol. 26(32): 4739-4752, 2020. doi: 10.3748/wjg.v26.i32.4739.

14. A. Idowu, A. Mzukwa, U. Harrison, P. Palamides, R. Haas, M. Mbao, R., et al. Detection of Helicobacter pylori and its virulence genes (cagA, dupA, and vacA) among patients with gastro duodenal diseases in Chris Hani Baragwaneth Academic Hospital, South Africa. BMC Gastroenterology. 19:73, 2019. doi: 10.1186/s12876-019-0986-0.

15. K. D. Salman, A. N. Al-Thwaini, I. A. Khalaf and B. A. Askar Designing of molecular tool for the detection of Helicobacter pylori in Iraqi patients using multiplex PCR technique. Annals of Tropical Medicine and Public Health. 22 (9), 2019. doi: 10.1136/jcp.49.2.107.

Received on 05.10.2021 Modified on 13.01.2022

Research J. Pharm. and Tech 2022; 15(10):4515-4518.

DOI: 10.52711/0974-360X.2022.00757